Réactivation de la réplication du virus de l’hépatite B accompagnée d’hépatite aiguë chez les patients recevant un traitement antirétroviral hautement actif

Réactivation de la réplication du virus de l’hépatite B accompagnée d’hépatite aiguë chez les patients recevant un traitement antirétroviral hautement actif

Nous décrivons une réactivation de la réplication du VHB au cours de la multithérapie antirétrovirale, indépendamment de la résistance à la lamivudine vérifier les informations suivantes. retrait de la lamivudine et malgré l’augmentation du nombre de cellules CD

Une réactivation de l’hépatite B chez des patients infectés par l’HBsAg a déjà été rapportée Même des patients ayant complètement récupéré du virus de l’hépatite B et ayant développé des anticorps anti-HBsAg peuvent présenter une récidive d’HBsAg et d’hépatite lors de co-infection VIH. Chez un certain nombre de patients recevant un traitement antirétroviral hautement actif HAART pour une infection par le VIH, des épisodes d’hépatite sévère associés au VHB ont été rapportés et expliqués par une reconstitution immunitaire induite par HAART Chez certains patients prenant de la lamivudine. traitement antirétroviral, l’apparition de VHB résistante à la lamivudine a été observée et peut avoir contribué au développement de l’hépatite Une forte augmentation du taux d’ADN sérique du VHB au cours du traitement antirétroviral hautement actif a été documentée chez le seul patient -HB pendant une longue période, et cette augmentation a été attribuée au retrait de la lamivudine W Au cours des dernières années, nous avons observé des patients ayant reçu un traitement antirétroviral hautement actif et ayant connu une réactivation de l’hépatite B. La présente étude rend compte de ces patients; La réactivation soudaine de la réplication du VHB et de l’hépatite pendant le traitement HAART ne peut être expliquée par l’arrêt du traitement par lamivudine ni par le développement d’une résistance aux analogues nucléosidiques. L’ADN du VHB dans le sérum a été quantifié par un test d’hybridation dot blot Pour la PCR, l’ADN du VHB à partir de μL de sérum a été purifié par digestion à la protéinase K et extraction au phénol-chloroforme, et les génomes du VHB de pleine longueur ont été amplifiés comme décrit précédemment. avec les amorces P et PP, les nucléotides HBV -, CCGGAAAGCTTGAGCTCTTC TTTTTCACCTCTGCCTAATCA; P, -, CCGGAAAGCTTGAGCTCTTC AAAAAGTTGCATGGTGCTGG; La limite de détection de cette PCR est de molécules par millilitre de sérum Les génomes amplifiés ont été digérés avec Sst I ou Hin dIII dans les séquences d’amorces hétérologues et clonés dans des séquences hétérologues pour faciliter le clonage en italique et le système Expand-High-Fidelity. Le vecteur pUC codant le locus YMDD catalytique et le domaine amont B de la polymérase HBV ainsi que le domaine antigénique majeur du déterminant a HBsAg ont été séquencés sur plusieurs génomes HBV clonés de chaque patient et ont été comparés aux séquences de type sauvage correspondantes Patient A était un homme infecté par le VIH âgé d’un an qui avait été positif pour les anticorps anti-HBs et anti-HBV anti-HBc et l’ADN du HBV négatif par PCR après la figure A Quatorze ans après le diagnostic du VIH, son nombre de cellules CD était de cellules / μL, et il s’est présenté avec Candida oesophagite Thérapie avec zidovudine mg / j, zalcitabine mg / j, et indinavir mg / j a été commencé Quatre mois plus tard, HBsAg a été détecté pour la première fois, mais l’ADN du VHB est resté indétectable par PCR & lt; molécules / mL Étant donné que la charge de VIH n’avait diminué que de l’ordre de grandeur, la multithérapie a été instaurée avec de la didanosine en mg / j, de la stavudine en mg / j et de l’indinavir en mg / j

Amivudine TC, thérapie antirétrovirale ART, ou thérapie antirétrovirale hautement active Les HAART sont indiqués par des barres au-dessus des parcelles. Influence du virus de l’hépatite B Infection par le VHB, y compris alanine aminotransférase ALT et taux d’ADN du VHB déterminés par immunotransfert Les valeurs inférieures à la limite de détection sont tracées à la limite, avec des pointes de flèche indiquant que les valeurs étaient inférieures à celles montrées. Trois mois plus tard, les lymphocytes CD avaient atteint les cellules / μL et l’ARN du VIH le test & lt; La didanosine a été remplacée par la lamivudine mg / j à la demande du patient Dans le même temps, une forte réplication du VHB était rétrospectivement évidente du taux sérique d’ADN du VHB de pg / ml × molécules / ml, mais l’hépatite cliniquement détectable était toujours absente. Le traitement antirétroviral a été interrompu parce que nous soupçonnions une toxicité hépatique induite par un médicament. L’IgM anti-HBc était positive, alors que les anticorps contre le virus de l’hépatite C et le VHC, les anticorps contre le virus de l’hépatite D, l’ARN du VHC. Après plusieurs semaines, les enzymes hépatiques se sont normalisées et le traitement a recommencé. Les taux d’ADN du VHB ont rapidement chuté à des niveaux indétectables et les anticorps anti-HBs sont réapparus plusieurs mois après la réactivation du VHB. Patient B, un homme du Zaïre, a été trouvé positif pour le VIH et les anticorps anti-HBs et anti-HBc, et négatif pour l’ADN du VHB par PCR. avec zidovudine mg / j et lamivudine mg / j lorsque les taux de CD ont chuté aux cellules / μL À ce moment, HBsAg était positif et, rétrospectivement, l’ADN du VHB était détectable par PCR mais pas par le test d’hybridation – molécules / mL. pas répondu au traitement, HAART a été commencé en Mars avec stavudine mg / j, didanosine mg / j, ritonavir mg / j, et saquinavir mg / j VIH ARN a diminué à des niveaux indétectables & lt; molécules / mL en mois La suppression du VIH est restée stable pendant des mois et s’est accompagnée d’une augmentation des lymphocytes CD aux cellules / μL; Le niveau d’ADN du VHB était de pg / ml × molécules / ml IgM anti-HBc était positif, alors que les anticorps contre le VHC, les anticorps contre le virus de l’hépatite D et l’ARN du VHC étaient négatifs. Les anticorps anti-HBs ont réapparu plusieurs mois après la réactivation, et l’ADN du VHB est devenu indétectable par PCR. Nous décrivons les patients co-infectés par le VHB et le VIH qui avaient Les deux sérums se sont résorbés en HBsAg et ont connu une réactivation forte et soudaine de la réplication du VHB au cours de la multithérapie. Chez le patient A, le taux d’ADN du VHB a augmenté d’au moins ordres de grandeur dans les mois après l’initiation de HAART Dans le patient B, l’ADN du VHB a augmenté d’au moins des ordres de grandeur entre le quatrième et s Le pic de la virémie hépatite B est survenu chez les deux patients lorsque la charge VIH était tombée en dessous de la limite de détection et que le nombre de cellules CD augmentait. Ceci est surprenant car il existe de fortes preuves que l’infection par le VHB est principalement contrôlée par l’immunité cellulaire. Une évolution clinique similaire a été récemment décrite et attribuée au retrait de la lamivudine du traitement anti-VIH quelques semaines avant la réactivation du VHB Chez le patient A, le retrait de la lamivudine ne peut pas être évité. expliquent l’augmentation de la réplication du VHB parce que le traitement par ce médicament a été initié au moment de la réactivation, pas avant. Chez le patient B, nous considérons également le retrait de la lamivudine comme une cause improbable de réactivation du VHB. le régime HAART pendant la réactivation du VHB plaide contre l’émergence de la résistance à la lamivudine souches, cette possibilité a été exclue par les résultats du séquençage de la partie de la polymérase du VHB présentant des mutations de résistance. La résistance à la lamivudine est invariablement associée aux mutations M → I ou M → V dans le locus YMDD catalytique; cette dernière mutation s’accompagne généralement d’une mutation L → M dans le domaine amont B Comme prévu, chez les patients de notre étude, aucune mutation n’a été retrouvée dans ces régions par rapport aux séquences HBV de type sauvage du génotype correspondant , séquences de transcriptase inverse Cette découverte exclut également largement la possibilité purement spéculative que tout autre analogue nucléotidique inclus dans le traitement des patients ait un effet inhibiteur négatif sur le VHB et a conduit à la sélection et à la découverte de VHB avec des mutations de résistance dans le domaine catalytique.

Figure View largeTélécharger des séquences d’acides aminés du virus de l’hépatite B HBV polymérase domaines B et C YMDD motif ainsi que de l’hépatite B surface antigène HBsAg déterminant a Un total de clones par isolat HBV isolat / du patient A et isolats /, /, et Les séquences des isolats du patient ont été comparées avec les séquences HBV de type sauvage du génotype correspondant: celle du patient A avec une séquence de type sauvage HBVADW spécifique au génotype A, et celles du patient B avec un génotype E Séquences d’acides aminés du virus de l’hépatite B Domaines de la polymérase du VHB Motifs B et C YMDD ainsi que de l’antigène de surface de l’hépatite B Déterminant de l’antigène HBsAg Un total de clones par isolat d’isolat du VHB / du patient A et Les isolats /, /, et / du patient B ont été séquencés Les séquences des isolats du patient ont été comparées aux séquences HBV de type sauvage du génotype correspondant: celle du patient A avec un génotype La séquence HBVADW de type sauvage spécifique à A et celles du patient B avec une séquence de type sauvage HHVBBAS spécifique au génotype E Comme les deux patients étaient initialement positifs pour les anticorps anti-HBs, l’apparition de HBsAg et de l’ADN du HBV peut être au moins partiellement due à sélection et accumulation de mutants d’échappement immunitaire avec des changements d’acides aminés dans les positions principales de l’épitope B de HBsAg -, comme cela a été décrit après immunisation passive et active avec anti-HBs et HBsAg, respectivement Chez le patient A, ce domaine était complètement conservé ; Cependant, plusieurs mutations ont été observées dans les régions amont et aval qui forment également des épitopes Figure, séquences HBsAg La pertinence des mutations dans ces régions est encore inconnue Chez le patient B, les mutations L → P et G → A se produisent dans l’épitope majeur modifie de manière prévisible l’antigénicité de HBs , les séquences HBsAg B / et / Des mutations supplémentaires ont été trouvées dans les régions amont et aval Les deux mutations de l’épitope majeur ainsi qu’une mutation Q → R ont été observées peu avant et au moment de la réactivation. mois plus tôt, séquences HBsAg B /, indiquant que les mutants correspondants ont été sélectionnés pendant cette période Leur émergence peut avoir contribué à la réactivation du VHB Au total, contrairement aux interprétations précédentes, le retrait de la lamivudine et le développement de la résistance au nucléoside les analogues sont soit exclus, soit hautement improbables d’être responsables de l’augmentation soudaine et forte de la réplication du VHB n Les patients de notre étude Cependant, un échappement d’anti-HBs peut être impliqué Alternativement ou en plus, il est concevable que HAART exerce un effet positif sur le niveau de réplication du VHB in vivo, comme suggéré par le lien temporel évident entre l’initiation de HAART et La réactivation du VHB D’autres observations soutiennent cette spéculation Par exemple, les taux sériques d’ARN du VHC augmentent également chez les patients co-infectés par le VIH et le VHC recevant un TARV Un mécanisme possible sous-jacent à ces effets a été récemment démontré in vitro. L’inhibiteur de la protéase ritonavir inhibe l’activité du protéasome et la présentation de l’antigène et réduit ainsi la réponse lymphocytaire T cytotoxique contre LCMV En analogie avec les observations chez les patients infectés par le VHB ou le VHC recevant un traitement HAART, L’administration de ritonavir à des souris infectées par le LCMV a finalement augmenté le titre du virus. Dans notre étude, l’épisode d’hépatite aiguë a été précédé ou accompagné du pic de virémie. Cela suggère que la réplication accrue du VHB était la cause principale de l’inflammation hépatique. La reconstitution induite par le HAART de certaines fonctions immunitaires cellulaires pourrait avoir un effet supplémentaire Déclencher le VHB réponse immunitaire spécifique peut même conduire à une récupération complète chez les patients avec un très faible nombre de cellules CD, comme indiqué par la réséroconversion aux anti-HBs et la clairance de l’ADN du VHB chez les patients et chez les patients précédemment signalés [,,] En outre, réactivation d’autres maladies virales chez les patients recevant le virus de l’hépatite C HAART et le cytomégalovirus ne s’expliquent pas exclusivement par une récupération immunologique, mais peuvent être interprétées comme un phénomène complexe impliquant la réactivation du pathogène et de la réponse immunitaire En conclusion, réactivation du VHB et de l’hépatite semble être une complication importante de la multithérapie antirétrovirale, et une étude plus poussée est justifiée Chez les patients HBsAg-positifs et anti-HBs positifs, la réactivation du VHB doit être surveillée après l’instauration du traitement antirétroviral et le traitement par lamivudine ou adéfovir peut être envisagé

Remerciements

Nous remercions A Jung, M Westerkofky et O Kühle pour leur excellente assistance technique

Contact Us

PEDIASLEEP
125 North Main Street
Suite 500-234
Blacksburg, VA 24060

Toll-Free: 1-800-269-8262